Class Notes

• A tutorial on finite-state-machines (read only pages 1-5)
• A game perspective on finite-state machines
• A short presentation of finite-state machines

• Notes on acceptors
• Download JFLAP application (requires Java to be installed) (see also the relevant part of the JFLAP applicaton  tutorial) 
• Download the JFLAP file for the US Currency example.
• Notes from the CS 3824 on the Genetic Code.
• Here is the gene sequence to use in testing your assignment on acceptors:

  atgaaggcaattatgttagtgaatttctgtgatgagcgcggtagtggtagatag 

  For more information on this gene see the NCBI GenBank.
  

• Notes on grammars (see also: brief tutorial)
• Download ANTLRWorks visualizer and interpreter for extended BNF (EBNF) (course web site or developer web site ) and a sample grammar.
• See the help pages for ANTLRWorks.

• Notes on abstraction.

• Several tutorials on XML ( A, B , C, D, E)  
• Download the XMLSpear tool and an XML file for a catalog of books.

• Notes on generalization
• Expressing generalizations in different forms

• Showing generalization in an XML schema

• Download and install Protege from class web site or from Protege home site.
• Here is the complete tutorial for using Protege
• Here is a highlighted version of the tutorial that we will follow during this class.
• A visualization component needed for Protege: download Graphviz from class web site or Graphviz home site. After installing Graphviz a configuration step is also needed as follows:
• In Protege, select Preferences under the File menu
• Select the OWL Viz tab
• in the field labelled "Dot Application Path" browse for where you installed  Graphviz and find an executable named "dot"
  (in my installation it is in  "C:\Program Files\Graphviz2.26.3\bin\dot.exe"

• The pizza ontology up to Section 4.8 (skipping section 4.7)

• Basic notes on Petri nets
• Some examples of Petri nets
• The Windows installer package for the Petri net tool
• The Mac OS X version of the Petri net tool
• The  Snoopy home site at Brandenburg University of Technology Cottbus

• Here are the Snoopy files for mutual exclusion and producer-consumer systems (these are the same examples used in the expanded notes)
• Here is a Snoopy solution for the Entry Door problem.

• here is the brief set of slides about the history of the lambda calculus
• here is a tutorial on the lambda calculus

• a zip file with the Lambda Teacher tool  (including a run.bat file)
• an interactive web page tutorial on the lambda calculus

• a testing applet for the triangle classifier problem

• an overview of black box testing techniques 

• building addresses in Japan vs. US (YouTube, text, Wikipedia)
• Pointers and Memory in C

• lecture notes on pointers and memory (PPTX, PDF)

• a course reflections document to edit